
CFTR TG-Tract/Poly-T Diplotype
This tool has been developed for the inter-conversion between HGVS nomenclature and TG-tract/polyT in CFTR intron 8. It is provided solely for investigational purposes and is not intended to serve as a definitive tool for the identification or accurate resolution of haplotypes or complex diplotypes. Users are hereby cautioned that reliance on its output for clinical, diagnostic, or legally binding determinations is expressly disclaimed.
​
The TG-tract poly‑T diplotype caller was developed for Sanger sequencing. However, it is inherently problematic because the superimposition of allelic signals in Sanger traces can lead to misassigned HGVS annotations. Sicko et al. implement an approach that involves quantifying TG repeats and poly‑T tracts directly from NGS FASTQ files, thereby improving enumeration accuracy (1). In contrast, Ding et al. require both forward and reverse Sanger sequencing traces to deconvolute superimposed signals, enabling accurate diplotype calling (2). Both of the aforementioned methods have been validated in a CLIA-certified laboratory setting.
​
Since (TG)11(T)7 is the designated reference sequence, a “no call” indicates that the sample conforms to this reference.
​
Please submit any Sanger-derived HGVS annotations that were not identified, along with the corresponding diplotype information. This will enhance the tool’s accuracy and benefit other users who are enumerating TG-tract and poly T variations in CFTR.
Enter HGVS input as: c.1210-11delinsGTG
Output:
Result #1
HGVS: c.1210-11delinsGTG
Zygosity: Heterozygous
Allele 1: (TG)13(T)5
Allele 2: (TG)11(T)7
Sequences:
GATGTGTGTGTGTGTGTGTGTGTGTGTGTTTTTAACAG
GATGTGTGTGTGTGTGTGTGTGTGTTTTTTTAACAG
Output
References
​
-
Sicko, R. J., Stevens, C. F., Hughes, E. E., Leisner, M., Ling, H., Saavedra-Matiz, C. A., ... & Kay, D. M. (2021). Validation of a custom next-generation sequencing assay for cystic fibrosis newborn screening. International journal of neonatal screening, 7(4), 73. https://doi.org/10.3390/ijns7040073
-
Ding, Q., Hofich, C. D., Kellogg, T. B., Kuennen, R. K., Paxton, K. N., Thieke, S. M., ... & Hasadsri, L. (2024). Accurate and Automated Genotyping of the CFTR Poly-T/TG Tract with CFTR-TIPS. International Journal of Molecular Sciences, 25(15), 8533. https://doi.org/10.3390/ijms25158533
CFTR TG/PolyT Diplotyper v1.03092025